GeneSpeak¶

A library to encode text as DNA and decode DNA to text.

GeneSpeak allows you to encode regular text as DNA using base-pairs (A, T, G, C) and convert back to the original text. Text encoding is done for both ascii and utf-8 characters based on the strategy keyword argument.

Background¶

A DNA molucule consists of a double-helix, where each strand is composed of a series of bases from the following four types:

• Adenine (A)
• Cytosine (C)
• Guanine (G)
• Thymine (T)

Adenine pairs with thymine, and cytosine pairs with guanine.

• A – T
• C – G

Source: https://www.genome.gov/genetics-glossary/acgt

Installation¶

You can install the library via pip or conda.

Install with pip

pip install genespeak

Install with conda

conda install -c conda-forge genespeak

Usage¶

import genespeak as gp
print(f'{gp.__name__} version: {gp.__version__}')

schema = "ATCG" # (1)
strategy = "ascii" # (2)
text = "Hello World!"

dna = gp.text_to_dna(text, schema=schema, strategy=strategy)
text_from_dna = gp.dna_to_text(dna, schema=schema, strategy=strategy)
print(f'Text: {text}\nEncoded DNA: {dna}\nDecoded Text: {text_from_dna}\n')

1. The schema parameter is used to determine how the text-to-dna conversion will be encoded. There are 24 possible values for schema: ACTG, AGCT, TACG, CATG, etc.

2. The strategy parameter determines whether to treat the text as ascii-only (strategy="ascii") or as utf-8 (strategy="utf-8"). For non-english text, or text with emojis, the utf-8 strategy must be used.

Output

genespeak version: 0.0.5

Text: Hello World!
Encoded DNA: TACATCTTTCGATCGATCGGACAATTTGTCGGTGACTCGATCTAACAT
Decoded Text: Hello World!